Development of a DNA Bar-coding Project as a Biology Laboratory Module
David Dunbar *, Caroline Nielsen
Science Department, Cabrini College, Radnor, PA 19087.
INTRODUCTION
This article is intended for faculty who are looking for new techniques for teaching a genetics or molecular ecology lab. We have used the bar-coding protocol for both a non-majors watershed ecology lab and a majors-specific genetics lab with equal success. The exercise involves extracting mitochondrial DNA from animal tissue, amplifying a portion of the mitochondrial DNA by the polymerase chain reaction (PCR), and sequencing the amplified DNA to determine the animal to the species level. Logistically, time spent on the DNA bar-coding procedure could be as short as 2–3 weeks or last an entire semester, depending on course outcomes and time availability. DNA bar-coding is a recently developed technique used to identify animal species level utilizing molecular genetics techniques. Typically, a 648 base pair region of the mitochondrial cytochrome oxidase (COI) gene is the primary sequence for animal species identification. The COI gene shows enough sequence divergence between animal species to use in identifying most animals to the species level. DNA bar-coding efficiently identifies diverse species from flies to fish, including from bits and pieces and other unrecognizable forms: eggs, larvae, damaged museum specimens, and even DNA shed into aquatic and terrestrial environments. There are several applications for DNA bar-coding. For instance, bar codes can document and confirm known species while uncovering lots of hidden variations, some of which may lead to the description of new species. Bar codes can be also be used to identify invasive species and detect animal parts from animals involved in illegal animal trades.
PROCEDURE
DNA bar-coding involves tissue DNA isolation, and polymerase chain reaction (PCR) amplification of the COI region using established universal oligonucleotide primers. A list of the required equipment necessary for a DNA bar-coding experiment is provided in Table 1. The oligonucleotide primer pair most often used for most DNA bar-coding projects are 5′GGTCAACAAATCATAAAGATATTGG3′ and 5′TAAACTTTCAGGGTGACCAAAAAATC3′. We typically have success for almost all of our animal tissue samples using the following PCR cycling conditions: 1 cycle at 94°C for 1 minute, 30 cycles at 94°C for 1 minute, 40°C for 1 minute, and 72°C for 1 minute, and the last cycle is for 3 minutes at 72°C. Confirmation of the correct sized PCR-amplified product is performed by agarose gel electrophoresis. We typically resolve PCR products on 2% agarose gel. Amplified DNA is purified using any number of established PCR purification kits, followed by DNA sequencing of the amplified product. (www.ncbi.nlm.nih.gov/blast). The DNA sequence can then be used in an NCBI BLAST (www.ncbi.nlm.nih.gov/blast) search analysis to determine what organism(s) gives a good match to the amplified bar code sequence. By conducting a BLAST search, the DNA bar code procedure can be used to confirm the identity of an animal species or reveal the identity of an animal species for which bar code data has not been previously recorded.
TABLE 1
.
Necessary equipment needed to successfully conduct DNA bar-coding experiments
We have successfully used several genomic DNA isolation procedures to isolate sufficient DNA for DNA bar-coding experiments. However, we have recently streamlined the DNA bar-coding procedure in the laboratory using a one-step DNA isolation/PCR amplification technique developed by Finnzymes Phire Animal Tissue Direct PCR Kit from Thermo Fisher Scientific Inc. (Waltham, MA). The complete directions for the kit can be obtained online at www.finnzymes.com/directpcr.
Basically, a very small amount of tissue is isolated and added to a PCR tube. Students typically isolate too much tissue sample from animal sources the first few times so instructors should stress that too much tissue can actually inhibit the PCR reaction. The amount of tissue is typically less than a Drosophila fly wing and most likely less than this, depending upon the tissue source. The amount of tissue needed for a successful PCR amplification reaction usually needs to be empirically determined and is dependent upon the tissue source.
Identification of the correct sized PCR product by aga-rose gel electrophoresis is followed by purification of the PCR product using the Promega Wizard PCR purification kit (Promega Corp., Madison, WI, cat# A9281). We have also used the Qiagen PCR purification kit (Qiagen, Germantown, MD, cat# 28104) with equal success in the purification of PCR products. Purification of PCR products is essential for high quality DNA needed for sequencing reactions. The concentration of purified PCR products is determined using the Quick-Load Low Molecular Weight DNA Ladder (cat# NO474S) from New England BioLabs (Ipswich, MA). We find the Low Molecular Weight DNA Ladder extremely useful in accurately measuring the concentration of low molecular weight DNA. We have not been able to obtain accurate DNA concentrations using conventional methods such as the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific Inc.). In our hands, spectrophotometers typically do not give accurate DNA concentrations with low molecular weight PCR products.
We next send our samples out for sequence determination using the Maine DNA Sequencing Facility at http://www2.umaine.edu/dnaseq/services.htm, although other comparable DNA sequencing providers are readily available. The Maine DNA Sequencing Facility specifically constructs sequencing primers based upon the identical sequences used for the PCR amplification reactions. DNA sequence is sent back electronically as a FASTA file for DNA bar code analysis.
Depending upon the goals of the class and the amount of time devoted to DNA bar-coding, an instructor and her/his class can start their own DNA bar-coding project and contribute to science by assigning a unique DNA bar code for their animal species of interest. Setting up a DNA bar-coding project can be accomplished by going to the Barcode of Life Data System (BOLD) at www.barcodinglife.org. BOLD is a bioinformatics workbench aiding the acquisition, storage, analysis, and publication of DNA bar code records (1) . By assembling molecular, morphological, and distributional data, it bridges a traditional bioinformatics chasm. BOLD is freely available to any researcher with an interest in DNA bar-coding. Because of its web-based delivery and flexible data security model, it is also well positioned to support projects that involve broad research alliances. The students in my genetics class have created a crayfish DNA bar-coding project to bar code a crayfish species native to a local watershed that happens to be in the Cambarus crayfish family. One of the exciting prospects of laboratory DNA bar-coding projects is that faculty and students alike gain a greater appreciation of animal taxonomy in a classical genetics laboratory. By conducting DNA bar-coding experiments, students learn important skills such as DNA isolation, PCR techniques, agarose gel electrophoresis, DNA sequencing methodologies, and bioinformatics.
CONCLUSION
This has been the first year we have incorporated a DNA bar-coding project into a genetics course but the student responses have been extremely positive. Five of the students asked if they could work with faculty on independent bar-coding projects after the semester was over and will continue with future bar-coding projects. Some of the student comments on the last day of class about the DNA bar-coding project are as follows:
-
♦ “The DNA bar-coding experiments were enjoyable for us as undergraduates because all procedures and results were not cut and dry.”
-
♦ “The bar-coding experiments felt like part of a larger team (BOLD), working toward results that are unique.”
-
♦ “After reading several papers about DNA bar-coding, one could see the practical applications for this technology.”
-
♦ “I learned that experiments in science are not guaranteed, even if there are instructions on how to execute the experiments.”
-
♦ “The bar-coding experiments helped us think like a scientist because our professor often consulted us in coming up with an action plan when experiments did not work.”
ACKNOWLEDGMENTS
DNA bar-coding experiments conducted in the Watershed Ecology were supported by a National Science Foundation Course Curriculum & Laboratory Improvement grant #0837511 titled “Watershed Citizenship Learning Community.”
REFERENCES
1
.
Ratnasingham, S., and P.D. Hebert
. 2007 BOLD: The barcode of live data system. Mol. Ecol. Notes.
7
(3):355–364.
*Corresponding author. Mailing address. Science Department, Cabrini College, 610 King of Prussia Road, Radnor, PA 19087. Phone: 610-902-8770. Fax: 610-902-8285. E-mail: ddunbar@cabrini.edu .
DOI: 10.1128/jmbe.v11i2.179
Journal of Microbiology & Biology Education
, December
2010
Copyright © 2010 American Society for Microbiology
. All Rights Reserved
JMBE
ISSN: 1935-7885
Journal of Microbiology & Biology Education